SIRT7 Stable Knockdown H1299 Cell Line
Cat. No.
T6165
Unit
1x10⁶ cells / 1 ml
Price
Inquiry

Worried about losing your cells due to growth or thawing difficulties, or even a random freezer breakdown? Enjoy peace of mind knowing that you can be covered under abm's Cell Line Insurance.

Sale of this item is subjected to the completion of a Material Transfer Agreement (MTA) by the purchasing institution.

For for-profit organizations, please contact quotes@abmgood.com for pricing.

Specifications
Description

SIRT7 Stable Knockdown HeLa Cell Line was generated by lentiviral driven expression of shRNAs. Lack of Sirt7 is associated with reduced recruitment of DNMT1 and Sirt1 at rRNA genes leading to hyperacetylation of histones, reduced DNA methylation, fragmentation of the nucleolar structure and loss of rDNA repeats leading to an increased spontaneous immortalization of primary mouse embryonic fibroblasts.

Cat. No. T6165
Name SIRT7 Stable Knockdown H1299 Cell Line
Unit 1x10⁶ cells / 1 ml
Price Inquiry
Category Stable Cell Lines
Cell Type Stable Cell Lines
Organism Human (H. sapiens)
Tissue Lung
Donor History Male, Caucasian, 43, Lymph node metastasis of the lung
Cell Morphology Epithelial-like
Growth Properties Adherent, epithelial-like
Seeding Density (cells/cm2) 10,000 - 20,000
Population Doubling Time 43 - 53
Expression Profile

Puromycin resistance at the concentration of 5 ug/mL. The cells stably express the short hairpin RNA (shRNA) scramble sequence: 5'-CCTAAGGTTAAGTCGCCCTCGCTCGAGCGAGGGCGACTTAACCTT AGG-3' and the Sirt7 specific shRNA 5'- CCGGGTCCAGCCTGAAGGTTCTAAACTCGAGTTTAGAACCTTCAGGCTGGACTTTTTG-3'.

Growth Conditions Use of PriCoat™ T25 Flasks (G299) or Applied Cell Extracellular Matrix (G422) is required for cell adhesion to the culture vessels. PriGrow III (TM003) + 10% FBS + 1% L-glutamine + 1% Penicillin/Streptomycin Solution (G255), 37.0°C, 5% CO₂
Subculture Protocol

Volumes given below are for a T75 flask; proportionally increase or decrease the volume as required per culture vessel size. Subculture cells once the culture vessel is 80% confluent.

1. Aspirate the culture media, and add 2-3ml of pre-warmed 0.25% Trypsin-EDTA to the culture vessel.

2. Observe the cells under a microscope to confirm detachment (typically within 2-10 minutes). Cells that are difficult to detach can be put in 37°C, for several minutes to facilitate detachment.

3. Neutralize Trypsin-EDTA by adding an equal volume of the complete growth media into the culture vessel.

4. Transfer the culture suspension into a sterile centrifuge tube, and centrifuge at 125xg for 5 minutes. The actual centrifuge duration and speed may vary depending on the cell type.

5. Aspirate the supernatant, and re-suspend the pellet with pre-warmed fresh complete growth media. Add appropriate aliquots of the cell suspension to new culture vessels, as desired.

6. Incubate the cells at the recommended conditions.

QC

1) Immunofluorescence; 2) DNA analysis and qPCR; 3) AgNOR staining

Application Research Use Only.
Storage Condition Vapor phase of liquid nitrogen, or below -130°C.
BioSafety II
Disclaimer

1. Sale of this item is subjected to the completion of a Material Transfer Agreement (MTA) by the purchasing individual/institution for each cell line. If you have any questions regarding this, please contact us at licensing@abmgood.com.

2. All test parameters provided in the CoA are conducted using abm's standardized culture system and The stated values may vary under the end-user's culture conditions. Please verify that the product is suitable for your studies by referencing published papers or ordering RNA (0.5 μg, Cat.# C207, $450.00) or cell lysate (100 μg, Cat.# C206, $600.00) to perform preliminary experiments, or alternatively use our Gene Expression Assay Service (Cat# C138). All sales are final.

3. We recommend live cell shipments for ease of cell transfer and this option can be requested at the time of order placement. Please note that the end-user will need to evaluate the feasibility of live cell shipment by taking into account the final destination's temperature variation and its geographical location.

4. All of abm's cell biology products are for research use ONLY and NOT for therapeutic/diagnostic applications. abm is not liable for any repercussions arising from the use of its cell biology product(s) in therapeutic/diagnostic or any other non-RUO application(s).

5. abm makes no warranties or representations as to the accuracy of the information on this site. Citations from literature are provided for informational purposes only. abm does not warrant that such information has been shown to be accurate.

6. abm warrants that cell lines shall be viable upon initiation of culture for a period of thirty (30) days after shipment and that they shall meet the specifications on the applicable abm Material Product Information sheet, certificate of analysis, and/or catalog description. Such thirty (30) day period is referred to herein as the "Warranty Period".

Depositor Max Planck Innovation GmbH
STR
There are no STR for this product yet!
FAQs
References
There are no references for this product yet!
Controls and Related Product:

CAT.NO
G299
UNIT
10 Flasks
PRICE
$58.00

CAT.NO
G422
UNIT
25ml
PRICE
$310.00

CAT.NO
G255
UNIT
100ml
PRICE
$42.00

CAT.NO
TM024
UNIT
100ml
PRICE
$445.00

CAT.NO
TM001
UNIT
500 ml
PRICE
$131.00

CAT.NO
TM002
UNIT
500 ml
PRICE
$131.00

CAT.NO
TM003
UNIT
500 ml
PRICE
$131.00

CAT.NO
TM004
UNIT
500 ml
PRICE
$131.00
Other Cell Lines
Select Species:
African Green Monkey (C. aethiops) (0)
Bat (0)
Bat (Chiroptera) (0)
Bee (0)
Bottlenose Dolphin (Tursiops) (0)
Cabbage Looper (T. ni) (0)
Cat (Feline) (0)
Cattle (0)
Chicken (Galline) (0)
Chinese Hamster (C. griseus) (0)
Cow (Bovine) (0)
Deer (Cervidae) (0)
Dog (Canine) (0)
Duck (Anas) (0)
Duck (Anatidae) (0)
E. coli (0)
European Sea Bass (0)
European Sea Bass (D. labrax) (0)
Fall Armyworm (S. frugiperda) (0)
Fish (0)
Fly (D. melanogaster) (0)
Frog (Xenopus) (0)
Fruit Fly (D. melanogaster) (0)
Gilthead Sea Bream (S. aurata) (0)
Goat (Capra) (0)
Golden Hamster (M. auratus) (0)
Goose (Anatidae) (0)
Green Monkey (C. aethiops) (0)
Green Monkey (C. sabaeus) (0)
Hamster (M. auratus) (0)
Horse (Equine) (0)
Human (0)
Human (H. sapiens) (0)
Insect (0)
Insect (Insecta) (0)
Killifish (F. heteroclitus) (0)
Luciola italica (0)
Marmoset (Primate) (0)
Mink (0)
Mink (N. vison) (0)
Monkey (Primate) (0)
Moth (S. frugiperda) (0)
Mouse (0)
Mouse (M. musculus) (0)
N/A (0)
Other (0)
Photinus pyralis (0)
Pig (Porcine) (0)
Quail (Coturnix) (0)
Rabbit (Leporidae) (0)
Rabbit (Leporine) (0)
Rainbow Trout (O. mykiss) (0)
Rat (R. norvegicus) (0)
Rat (Rattus) (0)
Renilla reniformis (0)
Roundworm (C. elegans) (0)
Rous Sarcoma Virus (RSV) (0)
SARS-CoV-2 (0)
Sheep (Ovine) (0)
Sheep (Ovis) (0)
Turtle (0)
Turtle (Testudines) (0)
Universal (0)
Zebrafish (D. rerio) (0)
Select Tissue:
0 (0)
Achilles Tendon (0)
Adipose (0)
Adrenal Gland (0)
Adrenal Glands (0)
Airway (0)
Airway/Lung (0)
Amniotic Sac (0)
Antimesometrial Decidua (0)
Antler (0)
Ascites (0)
Auditory (0)
Bee Cell (0)
Bile Duct (0)
Bladder (0)
Blood (0)
Blood (Immune) (0)
Blood Vessel (0)
Bone (0)
Bone Marrow (0)
Brain (0)
Breast (0)
CAF, Tumor (0)
Caput Epididymis (0)
Cartilage (0)
Cerebrospinal Fluid (0)
Cervix (0)
Colon (0)
Connective Tissue (0)
Cord Blood (0)
Digestive (0)
Digestive System (0)
Ear (0)
Embryo (0)
embryonic (0)
Endometria (0)
Endometrium (0)
Esophagus (0)
Eye (0)
Fallopian Tube (0)
Fibroblast (0)
Gingiva (0)
Hair (0)
Hair Follicle (0)
Head/Neck (0)
Heart (0)
HeLa (0)
Hepatocellular Carcinoma (0)
Hippocampus (0)
Intestinal (0)
Intestine (0)
Kidney (0)
Kidney, Cortex/Proximal tubule (0)
Labial Salivary Gland (0)
Larynx (0)
Liver (0)
Lung (0)
Lung Carcinoma (0)
Lung, bronchus (0)
Lymph (0)
Lymph node (0)
Lymphatic System (0)
lymphoblast (0)
Malignant melanoma (0)
Mammary (0)
Mesencephalic Tissue (0)
Mesentery (0)
Microglia (0)
Mouth/Oral (0)
Muscle (0)
Myoblast (0)
Nasal Mucosa (0)
Nerve (0)
Nervous System (0)
Oesophageal (0)
Oesophagus (0)
Oral (0)
Organ of Corti (0)
Other (0)
Ovary (0)
Pancreas (0)
Pancreatic (0)
Parathyroid (0)
Penile (0)
Peripheral Blood (0)
Peripheral Blood Mononuclear Cells (0)
Peritoneal (0)
Peritoneum (0)
Pharynx (0)
Pituitary (0)
Pituitary Gland (0)
Pituitary Tumor (0)
Placenta (0)
promyelocytic leukemia (0)
Prostate (0)
Prostate carcinoma (0)
Renal (0)
Reproductive (0)
Reproductive System (0)
Retina (0)
Salivary Gland (0)
Sciatic Nerve (0)
Sertoli (0)
Skeletal (0)
Skeletal Muscle (0)
Skin (0)
Skin ; Keratinocytes (0)
Small intestine (0)
Smooth Muscle (0)
Soft Tissue (0)
Spinal (0)
Spleen (0)
Stem Cell (0)
Stomach (0)
Straitum (0)
Sweat Gland (0)
Tendon (0)
Testes (0)
Testis (0)
Thymic (0)
Thymus (0)
Thyroid (0)
Tongue (0)
Tonsil (0)
Trachea (0)
Tumor (0)
Umbilical Cord (0)
Unknown (0)
Urethra (0)
Urinary Tract (0)
Uterus (0)
Uterus; endometrium (0)
Vascular Endothelium (0)
Ventral Mesencephalon (0)
Vertebral Disc (0)