Complete Package with protein production
Cat. No.
C487
Unit
Single Service
Price
Inquiry
Specifications
| SKU | C487 |
| Name | Complete Package with protein production |
| Unit | Single Service |
Documents
Supporting Protocol
FAQs
| pLenti-EF1α-hTERT-YFP, will it produce a fusion product? Can it be used to study translocation? Which filter do I have to use to see YFP? | |
|
hTert is linked to YFP by 2A. Since 2A has 'cleavage' activity by tricking the ribosomes to skip, hTERT and YFP will NOT be translated as a fusion product, but as separate proteins; As a result, the construct may not be suitable for studying translocation from cytoplasm to nucleus.
YFP’s peak excitation and emission wavelengths are 513 nm and 527 nm. Both GFP and YFP can be excited with a 488 nm blue laser.
|
| I would like to immortalize antigen specific mouse T cells to generate a clonal antigen specific T cell line. What would you suggest is the best method that you have experience with? How much would it be for you do accomplish this? | |
|
We have been able immortalize essentially any cell type including difficult to immortalize human hepatocytes and brain cells, but not T cells. We tried a couple of times before for other clients, but all have failed. The reason is that T cells are resistant to both transfection and lentiviral infection. So the immortalization gene can not get into the cells. We now learned that retrovirus can have limited transduction efficiency on T cells. So we can give it a try for you.
|
| Can your hTERT lentivirus immortalize other mammalian primary cells of non human origins? | |
|
Yes, we have successfully used it on mouse and rat cells.
|
| Do the usual antibiotics (penicillin and streptomycin) or a fungicide (amphotericin B) usually being added to the primary epithelial cell cultures interfere with the immortalization process via SV40 large T antigen (lower somehow the transfection efficiency)? Must we remove the above compounds before immortalization with a retroviral or a lentiviral vector? | |
|
Normally all the routine antibiotics do not interfere the infection efficiency of lenti/retro viral vectors.
|
| I want to immortalize human B cells. What are your best products for this. | |
|
EBV and Lenti-SV40 may be the best approach but this will need to be tested and optimized the end user.
|
| I work on marine mammal cell lines. Would this method work with seal and beluga primary kidney cell lines? I use them for virus isolation. Which method would you try first? | |
|
We have immortalized bee cells before and other lower species. We would recommend using Lenti-SV40 first. Additionally we do offer custom immortalization using all of our immortalization reagents we have. It is affordable and we will not charge you if the project fails.
|
| I would like to know if hTERT could immortalize bovine B cells? If no, do you have any product for immortalization of such cells? | |
|
Cell immortalization is a complicated process that is still not very well understood. ABM offers a wide range of immortalizing agents (http://www.abmgood.com/Cell-Immortalization.html) for you to choose from, depending on the cell type and subsequent studies the reagents may differ. For bovine B cells, we would suggest the use of SV40 antigen as this is the most potent immortalizing agent.
ABM also offers custom cell immortalization service (http://www.abmgood.com/Primary-Cell-Immortalization.html). There will be no charge if the project fails. Please contact order@abmgood.com to inquire quotes or to place an order.
|
| Which are the excitation and emission wavelengths of the RFP protein expressed by your lentiviral vector? | |
|
Excitation/emission maxima are 553 and 574 nm, respectively.
|
| What is the cell density that the customer should use for lentivirus and adenovirus infection? | |
|
Lentivirus 20-30%
Adenovirus 70%.
|
| Have your hTERT lentiviral (or retroviral) systems been used successfully to immortalize human hematopoetic cells such as B lymphoma cells? If it is not so, can you recommend a successful rate? | |
|
For hematopoetic cells, we would recommend to use our SV40 lentiviral system. SV40 is a more potent immortalization gene when compared to hTERT, thus it will greatly increase the success rate. abm has been able to immortalize bovine lymphocytes successfully using high titer SV40 lentivirus.
|
| What primers do I use to detect hTERT expression? | |
|
qPCR primers:
Forward: TGGTTTCTGTGTGGTGTCA
Reverse: TTGTCGCCTGAGGAGTAGA
|
| What primers do I use to detect HPV16 E6/E7 expression? | |
|
Forward: 5' TTGCAGATCATCAAGAACACGTAGA
Reverse: 5’ CAGTAGAGATCAGTTGTCTCTGGTTGC
When using these primers, the expected band size will be 112bp.
|
| What is the species or source of RFP and YFP? Discosoma e.g. Aequorea | |
|
Both the YFP and RFP sequence are synthetic sequence which has been codon optimized.
|
| I am wondering since you have Lenti-hTERT Virus and Lenti-hTERT antisense Virus, which one I should chose for immortalizing human epithelial cells? Is the antisense a control? | |
|
You will need to use Lenti-hTERT Virus (Cat. G200) for the immortalization step. The antisense virus is for silencing expression of hTERT if required, after the cells have been immortalized with G200.
|
| Can you summarize the cell immortalization process? | |
|
It is important to have a control when you perform the immortalization experiment. This means you should seed at least two wells in the 6 well dish.
One well will be used for viral transduction and the other will remain un-transduced. If there is no selection marker, you will have to compare the growth rates between the transduced and non-transduced as well as whether the transduced cells go pass their normal passage of senescence (easier to note if they have a control side by side when passaging).
We suggest to use 1-2mL of viral supernatant to start in the presence of polybrene (at a final concentration of 2-10 ug/ml) directly into the 6-well plate. If there is a strong toxic effect on the cells, you can consider adding fresh media but note that this will dilute the viral concentration.
You do not have to passage after 48/72 hours if the cells in the 6 well has not reached confluency. After you have passaged to 100mm dishes, keep passaging until the cells go beyond their passaging limit. From there, you can pick monoclones and check insert expression using Western Blotting, PCR, qPCR,etc.
|
| How many rounds of immortalization will 10ml of viral reagent give me? | |
|
This will be entirely depended on your experimental parameters (cell type, seeding density etc.) and therefore cannot be determined. We would advise carrying out a pilot experiment with a GFP control lentivirus (LV006) in order to determine an optimal MOI for your experiments before carrying out the immortalization steps.
|
| Can you provide the hTERT sequence expressed with these constructs? | |
|
The CDS region of hTERT transcript variant 1: NM_198253.2. http://www.ncbi.nlm.nih.gov/nuccore/NM_198253.2
|
| Does lentiviral titer deteriorate with every freeze thaw? | |
|
Yes, there will be a decline in the lentiviral titer with every freeze-thaw. If you do not intend to use the full volume of virus in your first round of immortalization experiments, we advise aliquoting your stock to avoid multiple freeze thaw cycles.
|
| Can you recommend a reagent and protocol to use for my project? | |
|
It is difficult to predict which immortalization reagent will provide the most successful clones in specific cases. Successful cell immortalization can be tricky and will need to be determined experimentally. We have experienced the most overall success in a range of mammalian cell types using the SV40 whole gene and hTERT lentiviral methods. A cell immortalization user guide is also available on our web site, containing a guideline protocol (http://www.abmgood.com/SV40-Cell-Immortalization.html). Please note, this will likely require optimization and we recommend carrying out preliminary experiments to determine the lentiviral infection efficiency of the cells using a Lenti-GFP control (LV006) before attempting the immortalization step.
|
| What temperature do you store the virus? | |
|
The virus should be stored at -80 degree C.
|
| I'm struggling to get a high % RFP expression using G441. Is this normal? | |
|
It is considered normal to obtain only a few cells expressing RFP in some cases, due to the lower strength of expression from the EF1a promoter (compared to a stronger promoter such as CMV).
Any RFP expressing cells (even if it is a very small number) will be stably transduced, therefore selection of even this small number of transduced cells can be carried out with Puromycin.
|
| How do I thaw the 10ml tube of virus supernatant? | |
|
It will be fine to thaw 10 ml lentiviral supernatant in a waterbath. This is not normally required for smaller vials as they will thaw relatively quickly once removed from the freezer.
|
| Does Lenti-hTERT virus show organ and species specificity of infection? | |
|
In general, there is no organ or species specificity. However, successfully immortalization of a target cell line will require successful infection first. The infection efficiency will be dependent on the specific cells you are working with and this will need to be determined experimentally.
|
| Which molecules (for example, receptor or co-receptor) does Lenti-hTERT virus need for infection? | |
|
All our lentiviruses are VSV-G pseudotyped because the vesicular stomatitis virus (VSV) exhibits a remarkably robust and pantropic infectivity. The use of VSV glycoprotein (VSV-G) gives broad tropism. Many believes that the VSV-G helps the virus enter cells through a highly ubiquitous receptor (whose identity remains elusive) while other suggest that the glycoprotein does not require any cell surface receptor. A recent PNAS study shows that LDL receptor (LDLR) may serve as the port of entry for VSV-G pseudotyped lentiviral vectors in human and in mouse.
http://www.pnas.org/content/110/18/7306.abstract
In short, there isn't really a documented receptor that is required for VSV-G-pseudotyped lentivirus entry to the cells.
|
| For the genes that were deleted to render the virus replication deficient, please describe how the deleted gene(s) and/or regulatory elements are provided in-trans. | |
|
The deleted genes and/or regulatory elements were provided in-trans during viral packaging through 2 different plasmids (packaging plasmids), ABM Cat# LV003. The missing elements are located in two different plasmids, and by co-transfection of these packaging plasmids with the HPV-16 E6/E7 plasmid, the virus could be packaged. The resulting virus is collected and purified, and does not contain either of the two packaging plasmids after purification, so the virus is replication deficient.
|
| Is this virus amphotropic or ecotropic? | |
|
Amphotropic. Our lentiviruses are pseudotyped with the vesicular stomatitis virus (VSV-G) glycoprotein.
|
| What species did the sequences of HPV E6/7 and the puromyocin resistance come from for Cat# G268? | |
|
The inserted genes (HPV E6/E7) were gene synthesized according to the reference sequence, Accession # NC_001526.2. The species is the Human papillomavirus type 16.
The puromycin resistance gene (Streptomyces alboniger puromycin N-acetyltransferase (pac) gene, Accession # M25346.1) was gene synthesized according to the reference sequence. The species is Streptomyces alboniger.
|
| Are E6 and E7 fused in frame to generate a single ORF? ie. Has the stop codon been removed? | |
|
The stop codon has not been removed between E6 and E7. The two genes comprise of the NCBI sequence (NC_001526.2), 776nt in length, including the middle stop codon (83-559 and 562-858).
|
| What sequencing primers can be used to pick up the hTERT sequence? | |
|
The suggested sequencing primers are below, and they should be close enough to pick up hTERT if used for sequencing.
CMV sequencing primer (~200bp upstream of hTERT)
5`---CGC AAA TGG GCG GTA GGC GTG---3`
SV40 reverse sequencing primer (~260bp downstream of hTERT)
5`---TAG TCA GCC ATG GGG CGG AGA ---3`
|
| For the Antibiotic Switching Service, can I change the gene to a resistance marker other than Puromycin or Neomycin? | |
|
If you would like other resistance markers, we would need the customer to provide the plasmid containing the marker, as well as the full sequence, and we can then look into details of the marker and see if it would be possible. Please email technical@abmgood.com for further information.
|
| What is the lead time for a knockout service? | |
|
4-5 months for a single gene knock-in.
|
| What should customers provide for this service? | |
|
Please supply the cells for this service. For frozen cells, please ship at least 2 vials (at least 10^6 each) on dry ice. An alternative method is to send us two T25 flask of live cells per sample, at 90% confluency. The flasks should be filled with complete medium without any air bubbles and at room temperature. Please ensure that the sterilization procedure is strictly observed. To avoid delays over the weekend, we recommend shipping the cells on a Monday or a Tuesday. Frozen cells are preferred over live cells.
If your cell line already contains an antibiotic resistance marker, please specify. Our vectors have puromycin resistance by default.
If your cells require medium other than DMEM and RPMI, we will also require 1L of the specified medium and any applicable growth factors or supplements to be provided by you for the project. Please submit all components of the complete media (e.g. if growth factors, cytokines etc. are applicable) individually to eliminate potential degradation of components in the media during transit. Kindly include instructions for making the complete media in your shipment. Additionally, please provide at least 5 x coated 6-well plates and 10 x T25 flasks if the cells require specially treated culture vessels. Once you have shipped your cells, please forward us the tracking number for custom clearance. Information on how to ship cell samples to abm can be found on our support page: https://www.abmgood.com/Technical-Support.html
Please place an order first prior to submitting your samples. All samples received must have the order confirmation number indicated. Any samples received without this piece of information will be disposed off immediately upon receipt to ensure that all customer information is held in strict confidence.
|
| Can this service be performed for canine derived cells? | |
|
Yes, we can use sgRNA targeting canine genome to make stable KI cell lines. Please provide the specific cell medium for canine cell culture.
|
| What information should I provide to get a quote? | |
|
Please complete the Service Questionnaire form under the documents section above and email to quotes@abmgood.com.
|
| Will CRISPR keep cutting the chromosome after the gene is edited? | |
|
CRISPR is sensitive to mismatches, so it is unlikely the CRISPR will keep cutting the chromosome after the gene is edited.
|
| How can you detect a mutation if there is no selection (by PCR using primers flanking the modified site or the T7 endonuclease I assay)? | |
|
Yes, that is one method used. Other methods include Sanger sequencing, and western blotting if the antibody is provided by the customer.
|
| What are the deliverables? | |
|
- Genetically Engineered Cell Line (up to 2 vials 1x10^6 cells/vial)
- Custom Report
|
| Can you offer this service in bacterial cells? | |
|
We offer CRISPR knockout and knockin on a custom inquiry basis. Please contact technical@abmgood.com with your project details.
|
| How is KI confirmed? | |
|
We perform PCR and Sanger sequencing of the locus of interest to confirm the knockin. For even greater certainty, we also offer Next Generation Sequencing confirmation (IA00100) to confirm the absence of WT alleles. Being much more sensitive, NGS screening is ideal for detecting complete editing of multiple copy genes, or polyploid cell lines.
|
| How should I thaw the EBV Virus? | |
|
We recommend to thaw the virus at room temperature or at 4C if it is not needed right away.
|
| What is the storage temperature of the EBV Virus? | |
|
-80C. You may also consider making smaller aliquots of the virus to avoid repeated freeze-thaw cycles.
|
| What primers can I use for EBV detection? | |
|
Forward 5'-AAA CCT CAG GAC CTA CGC TGC -3'
Reverse 5'-AGA CAC CGT CCT CAC CAC-3'
|
References
- Balducci, L et al. "Immortalization of human adipose-derived stromal cells: production of cell lines with high growth rate, mesenchymal marker expression and capability to secrete high levels of angiogenic factors" Stem Cell Research & Therapy 3:63 (2014). DOI: 10.1186/scrt452. PubMed: 24887516. Application: hTERT, SV40, HPV-16 E6/E7.
- Balducci, L et al. "Immortalization of human adipose-derived stromal cells: production of cell lines with high growth rate, mesenchymal marker expression and capability to secrete high levels of angiogenic factors" Stem Cell Research & Therapy 3:63 (2014). DOI: 10.1186/scrt452. PubMed: 24887516. Application: hTERT, SV40, HPV-16 E6/E7.
- McNally, E., & Wyatt, E. "U" S. Patent Application No. 16/395 741: (2019).